MtbRegList

Internal user

Quickfind:

Gene information

Caracteristics
   
  • Name:
  • Rv0005
  • Synonym(s):
  • gyrB
  • From:
  • 5123
  • To:
  • 7267
  • Length:
  • 2145
  • Orientation:
  • +
  • TubercuList product description:  
  • DNA GYRASE (SUBUNIT B) GYRB (DNA TOPOISOMERASE (ATP-HYDROLYSING)) (DNA TOPOISOMERASE II) (TYPE II DNA TOPOISOMERASE)
  • Other product information
  • TubercuList Link

  • Genomic region view

    Genes, motifs and intergenic regions are clickable. At high zoom, nucleotide values are shown.

    Related Annotated DNA motif
    Related Annotated TSS
    Sequence (5'=>3')
       
    ATGGGTAAAAACGAGGCCAGAAGATCGGCCCTGGCGCCCGATCACGGTACAGTGGTGTGCGACCCCCTGCGGCGA
    CTCAACCGCATGCACGCAACCCCTGAGGAGAGTATTCGGATCGTGGCTGCCCAGAAAAAGAAGGCCCAAGACGAA
    TACGGCGCTGCGTCTATCACCATTCTCGAAGGGCTGGAGGCCGTCCGCAAACGTCCCGGCATGTACATTGGCTCG
    ACCGGTGAGCGCGGTTTACACCATCTCATTTGGGAGGTGGTCGACAACGCGGTCGACGAGGCGATGGCCGGTTAT
    GCAACCACAGTGAACGTAGTGCTGCTTGAGGATGGCGGTGTCGAGGTCGCCGACGACGGCCGCGGCATTCCGGTC
    GCCACCCACGCCTCCGGCATACCGACCGTCGACGTGGTGATGACACAACTACATGCCGGCGGCAAGTTCGACTCG
    GACGCGTATGCGATATCTGGTGGTCTGCACGGCGTCGGCGTGTCGGTGGTTAACGCGCTATCCACCCGGCTCGAA
    GTCGAGATCAAGCGCGACGGGTACGAGTGGTCTCAGGTTTATGAGAAGTCGGAACCCCTGGGCCTCAAGCAAGGG
    GCGCCGACCAAGAAGACGGGGTCAACGGTGCGGTTCTGGGCCGACCCCGCTGTTTTCGAAACCACGGAATACGAC
    TTCGAAACCGTCGCCCGCCGGCTGCAAGAGATGGCGTTCCTCAACAAGGGGCTGACCATCAACCTGACCGACGAG
    AGGGTGACCCAAGACGAGGTCGTCGACGAAGTGGTCAGCGACGTCGCCGAGGCGCCGAAGTCGGCAAGTGAACGC
    GCAGCCGAATCCACTGCACCGCACAAAGTTAAGAGCCGCACCTTTCACTATCCGGGTGGCCTGGTGGACTTCGTG
    AAACACATCAACCGCACCAAGAACGCGATTCATAGCAGCATCGTGGACTTTTCCGGCAAGGGCACCGGGCACGAG
    GTGGAGATCGCGATGCAATGGAACGCCGGGTATTCGGAGTCGGTGCACACCTTCGCCAACACCATCAACACCCAC
    GAGGGCGGCACCCACGAAGAGGGCTTCCGCAGCGCGCTGACGTCGGTGGTGAACAAGTACGCCAAGGACCGCAAG
    CTACTGAAGGACAAGGACCCCAACCTCACCGGTGACGATATCCGGGAAGGCCTGGCCGCTGTGATCTCGGTGAAG
    GTCAGCGAACCGCAGTTCGAGGGCCAGACCAAGACCAAGTTGGGCAACACCGAGGTCAAATCGTTTGTGCAGAAG
    GTCTGTAACGAACAGCTGACCCACTGGTTTGAAGCCAACCCCACCGACGCGAAAGTCGTTGTGAACAAGGCTGTG
    TCCTCGGCGCAAGCCCGTATCGCGGCACGTAAGGCACGAGAGTTGGTGCGGCGTAAGAGCGCCACCGACATCGGT
    GGATTGCCCGGCAAGCTGGCCGATTGCCGTTCCACGGATCCGCGCAAGTCCGAACTGTATGTCGTAGAAGGTGAC
    TCGGCCGGCGGTTCTGCAAAAAGCGGTCGCGATTCGATGTTCCAGGCGATACTTCCGCTGCGCGGCAAGATCATC
    AATGTGGAGAAAGCGCGCATCGACCGGGTGCTAAAGAACACCGAAGTTCAGGCGATCATCACGGCGCTGGGCACC
    GGGATCCACGACGAGTTCGATATCGGCAAGCTGCGCTACCACAAGATCGTGCTGATGGCCGACGCCGATGTTGAC
    GGCCAACATATTTCCACGCTGTTGTTGACGTTGTTGTTCCGGTTCATGCGGCCGCTCATCGAGAACGGGCATGTG
    TTTTTGGCACAACCGCCGCTGTACAAACTCAAGTGGCAGCGCAGTGACCCGGAATTCGCATACTCCGACCGCGAG
    CGCGACGGTCTGCTGGAGGCGGGGCTGAAGGCCGGGAAGAAGATCAACAAGGAAGACGGCATTCAGCGGTACAAG
    GGTCTAGGTGAAATGGACGCTAAGGAGTTGTGGGAGACCACCATGGATCCCTCGGTTCGTGTGTTGCGTCAAGTG
    ACGCTGGACGACGCCGCCGCCGCCGACGAGTTGTTCTCCATCCTGATGGGCGAGGACGTCGACGCGCGGCGCAGC
    TTTATCACCCGCAACGCCAAGGATGTTCGGTTCCTGGATGTCTAA