MtbRegList

Internal user

Quickfind:

Gene information

Caracteristics
   
  • Name:
  • Rv0003
  • Synonym(s):
  • recF
  • From:
  • 3280
  • To:
  • 4437
  • Length:
  • 1158
  • Orientation:
  • +
  • TubercuList product description:  
  • DNA REPLICATION AND REPAIR PROTEIN RECF (SINGLE-STRAND DNA BINDING PROTEIN)
  • Other product information
  • TubercuList Link

  • Genomic region view

    Genes, motifs and intergenic regions are clickable. At high zoom, nucleotide values are shown.

    Related Annotated DNA motif
    Signature ?Recognized by ?Root ?Dist 5' ?Dist 3' ?Strand ?Trx Impact ?Exp Evid ?Reference ?
    TATGGTAAGACGAATCTTA@
    6
    Rv2711 (IdeR, DtxR)TTAGGNWAGSCTWVCCTAA991040+UndefHOM Gold et al. (2001) Mol Microbiol, 42;

    Related Annotated TSS
       No related TSS

    Sequence (5'=>3')
       
    GTGTACGTCCGTCATTTGGGGCTGCGTGACTTCCGGTCCTGGGCATGTGTAGATCTGGAATTGCATCCAGGGCGG
    ACGGTTTTTGTTGGGCCTAACGGTTATGGTAAGACGAATCTTATTGAGGCACTGTGGTATTCGACGACGTTAGGT
    TCGCACCGCGTTAGCGCCGATTTGCCGTTGATCCGGGTAGGTACCGATCGTGCGGTGATCTCCACGATCGTGGTG
    AACGACGGTAGAGAATGTGCCGTCGACCTCGAGATCGCCACGGGGCGAGTCAACAAAGCGCGATTGAATCGATCA
    TCGGTCCGAAGTACACGTGATGTGGTCGGAGTGCTTCGAGCTGTGTTGTTTGCCCCTGAGGATCTGGGGTTGGTT
    CGTGGGGATCCCGCTGACCGGCGGCGCTATCTGGATGATCTGGCGATCGTGCGTAGGCCTGCGATCGCTGCGGTA
    CGAGCCGAATATGAGAGGGTGTTGCGCCAGCGGACGGCGTTATTGAAGTCCGTACCTGGAGCACGGTATCGGGGT
    GACCGGGGTGTGTTTGACACTCTTGAGGTATGGGACAGTCGTTTGGCGGAGCACGGGGCTGAACTGGTGGCCGCC
    CGCATCGATTTGGTCAACCAGTTGGCACCGGAAGTGAAGAAGGCATACCAGCTGTTGGCGCCGGAATCGCGATCG
    GCGTCTATCGGTTATCGGGCCAGCATGGATGTAACCGGTCCCAGCGAGCAGTCAGATATCGATCGGCAATTGTTA
    GCAGCTCGGCTGTTGGCGGCGCTGGCGGCCCGTCGGGATGCCGAACTCGAGCGTGGGGTTTGTCTAGTTGGTCCG
    CACCGTGACGACCTAATACTGCGACTAGGCGATCAACCCGCGAAAGGATTTGCTAGCCATGGGGAGGCGTGGTCG
    TTGGCGGTGGCACTGCGGTTGGCGGCCTATCAACTGTTACGCGTTGATGGTGGTGAGCCGGTGTTGTTGCTCGAC
    GACGTGTTCGCCGAACTGGATGTCATGCGCCGTCGAGCGTTGGCGACGGCGGCCGAGTCCGCCGAACAGGTGTTG
    GTGACTGCCGCGGTGCTCGAGGATATTCCCGCCGGCTGGGACGCCAGGCGGGTGCACATCGATGTGCGTGCCGAT
    GACACCGGATCGATGTCGGTGGTTCTGCCATGA