MtbRegList

Internal user

Quickfind:

Gene information

Caracteristics
   
  • Name:
  • Rv0001
  • Synonym(s):
  • dnaA
  • From:
  • 1
  • To:
  • 1524
  • Length:
  • 1524
  • Orientation:
  • +
  • TubercuList product description:  
  • CHROMOSOMAL REPLICATION INITIATOR PROTEIN DNAA
  • Other product information
  • TubercuList Link

  • Genomic region view

    Genes, motifs and intergenic regions are clickable. At high zoom, nucleotide values are shown.

    Related Annotated DNA motif
       No related DNA pattern

    Related Annotated TSS
       No related TSS

    Sequence (5'=>3')
       
    TTGACCGATGACCCCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGAACTTAACGGCGACCCTAAG
    GTTGACGACGGACCCAGCAGTGATGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTGGCTCAATCTC
    GTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTATCCGTGCCGAGCAGCTTTGTCCAAAACGAAATCGAG
    CGCCATCTGCGGGCCCCGATTACCGACGCTCTCAGCCGCCGACTCGGACATCAGATCCAACTCGGGGTCCGCATC
    GCTCCGCCGGCGACCGACGAAGCCGACGACACTACCGTGCCGCCTTCCGAAAATCCTGCTACCACATCGCCAGAC
    ACCACAACCGACAACGACGAGATTGATGACAGCGCTGCGGCACGGGGCGATAACCAGCACAGTTGGCCAAGTTAC
    TTCACCGAGCGCCCGCACAATACCGATTCCGCTACCGCTGGCGTAACCAGCCTTAACCGTCGCTACACCTTTGAT
    ACGTTCGTTATCGGCGCCTCCAACCGGTTCGCGCACGCCGCCGCCTTGGCGATCGCAGAAGCACCCGCCCGCGCT
    TACAACCCCCTGTTCATCTGGGGCGAGTCCGGTCTCGGCAAGACACACCTGCTACACGCGGCAGGCAACTATGCC
    CAACGGTTGTTCCCGGGAATGCGGGTCAAATATGTCTCCACCGAGGAATTCACCAACGACTTCATTAACTCGCTC
    CGCGATGACCGCAAGGTCGCATTCAAACGCAGCTACCGCGACGTAGACGTGCTGTTGGTCGACGACATCCAATTC
    ATTGAAGGCAAAGAGGGTATTCAAGAGGAGTTCTTCCACACCTTCAACACCTTGCACAATGCCAACAAGCAAATC
    GTCATCTCATCTGACCGCCCACCCAAGCAGCTCGCCACCCTCGAGGACCGGCTGAGAACCCGCTTTGAGTGGGGG
    CTGATCACTGACGTACAACCACCCGAGCTGGAGACCCGCATCGCCATCTTGCGCAAGAAAGCACAGATGGAACGG
    CTCGCGGTCCCCGACGATGTCCTCGAACTCATCGCCAGCAGTATCGAACGCAATATCCGTGAACTCGAGGGCGCG
    CTGATCCGGGTCACCGCGTTCGCCTCATTGAACAAAACACCAATCGACAAAGCGCTGGCCGAGATTGTGCTTCGC
    GATCTGATCGCCGACGCCAACACCATGCAAATCAGCGCGGCGACGATCATGGCTGCCACCGCCGAATACTTCGAC
    ACTACCGTCGAAGAGCTTCGCGGGCCCGGCAAGACCCGAGCACTGGCCCAGTCACGACAGATTGCGATGTACCTG
    TGTCGTGAGCTCACCGATCTTTCGTTGCCCAAAATCGGCCAAGCGTTCGGCCGTGATCACACAACCGTCATGTAC
    GCCCAACGCAAGATCCTGTCCGAGATGGCCGAGCGCCGTGAGGTCTTTGATCACGTCAAAGAACTCACCACTCGC
    ATCCGTCAGCGCTCCAAGCGCTAG