MtbRegList

Internal user

Quickfind:

Intergenic Region information

Caracteristics
   
  • Name:
  • irP_Rv0002_Rv0003
  • From:
  • 3261
  • To:
  • 3279
  • Length:
  • 19
  • Status ?:
  • P

    Genomic region view

    Genes, motifs and intergenic regions are clickable. At high zoom, nucleotide values are shown.

    Related Annotated DNA motif ?
       No related DNA pattern

    Related Annotated TSS ?
       No related TSS

    Sequences (5'=>3')
    • Positive Sequence *
      GCACTTGGCGCCCGGGTAG
    • Negative Sequence **
      CTACCCGGGCGCCAAGTGC
    • Positive 5' flanking 200 bp *
      CAACCTATCTAACGGACGGTTTGAGTTCGTTGCGCTCGGAGCGAGTGTCTTTCGGGTTTACGACTGCGGGTAAGC
      CTGCCTTGCTACGTCCGGTGTCCGGGGACGATCGCCCTGTGGCGGGTCTGAATGGCAACGGTCCGTTCCCGGCGG
      TGTCGACGGACTATGTCTATCTGTTGATGCCGGTTCGGTTGCCGGGCTGA
    • Positive 3' flanking 200 bp *
      GTGTACGTCCGTCATTTGGGGCTGCGTGACTTCCGGTCCTGGGCATGTGTAGATCTGGAATTGCATCCAGGGCGG
      ACGGTTTTTGTTGGGCCTAACGGTTATGGTAAGACGAATCTTATTGAGGCACTGTGGTATTCGACGACGTTAGGT
      TCGCACCGCGTTAGCGCCGATTTGCCGTTGATCCGGGTAGGTACCGATCG
    • Negative 5' flanking 200 bp **
      CGATCGGTACCTACCCGGATCAACGGCAAATCGGCGCTAACGCGGTGCGAACCTAACGTCGTCGAATACCACAGT
      GCCTCAATAAGATTCGTCTTACCATAACCGTTAGGCCCAACAAAAACCGTCCGCCCTGGATGCAATTCCAGATCT
      ACACATGCCCAGGACCGGAAGTCACGCAGCCCCAAATGACGGACGTACAC
    • Negative 3' flanking 200 bp **
      TCAGCCCGGCAACCGAACCGGCATCAACAGATAGACATAGTCCGTCGACACCGCCGGGAACGGACCGTTGCCATT
      CAGACCCGCCACAGGGCGATCGTCCCCGGACACCGGACGTAGCAAGGCAGGCTTACCCGCAGTCGTAAACCCGAA
      AGACACTCGCTCCGAGCGCAACGAACTCAAACCGTCCGTTAGATAGGTTG
    * Positive sequence: Sequence as publish in the genome sequencing project
    ** Negative sequence: Reverse complement sequence